jello skeleton

wolfiestardust:

taco-bell-rey:

Porn blogs still posting porn until December 17th is the equivalent of the band playing while the Titanic was sinking.

titanic: sinking
band: playing
tits: out (for now)

(via servicedoodle)

witchoffires:

witchoffires:

witchoffires:

my little sister just found out at school that you can create a religion and wants me to help her turn Halloween into a year long religion. And i  never knew i wanted this until now. We will be the Halloween Cult. I am so ready for this.

My sister came up with some cult rules.

1. Do not deny the spooky.
   
2. Be nice to children.
   
3. Don’t be pressuring others into the religion, if they don’t want to hear leave them alone.
   
4. Every second Wednesday of each month is Pumpkin Worship, that is when you eat pumpkin flavored things, carve pumpkins, or burn pumpkin spice scented candles. Just embrace the pumpkin.
   
5. Don’t be mean to other people for reasons they can’t control, but hey if they are doing it on purpose just to annoy you, destroy them.
   
6. No touch other people if they don’t want you to, this includes hair.
   
7. Halloween is a holy day, embrace it and become one with the spooky.
   
8. Costumes are an everyday thing, but sometimes it can be inappropriate, be aware of when to embrace the spooky and when to just be a little spooky.
   
9. Don’t let anyone tell you you can’t be spooky, and if they do tell you then they don’t know what they’re talking about. You can be all the spooky all you want.
   
10. Be nice to animals.
    
11. Be ready to help others when you can but still remember that you need to put your needs first.
    
12. You are spooky, you are amazing, you are fabulous. Say it.
    
13. idk but i think we need more, go ask you internet nerd friends.
    

can yall think of anything else?

OKay i asked her how one would join the cult and she said to light a jack-o-lantern on a full moon then yodel into the night for the pumpkin king and if he approves you, you will hear someone yell “stut the fuck up” then you are part of the cult.

have fun yodeling my friends

(via phoenixonwheels)

traumadic:

person: why are you drinking coffee, don’t you have anxiety?? won’t that make it worse??

me:

(via servicedoodle)

colaismywater:

Female presenting nipple

(via skygenders)

intranet:

Incase anything happens to my account here’s my entire genome:

GATTTACTCGTACGGTACGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGYTTCCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATTAOCGGTACGATCCCGTAGGGTAGGGGGTTAATTGGCTCTGAGGGTTCTYCTCAATCCTCAATCAATCCTCHUATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGAATTCCAATCAATCCTCAATCATCAATCAACTCKAATCAATCCTCHATCTNACCCCCTTTAFCOGATCCCGTAGGGTAGGATCCTCATCTACCCTTCCTTTAFCGATCCCGTAGWGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTGATTTACTCGTACGGTACGATCCCGTAGGGTAGGGGGTTAAGGCTCTGIAGGGTTCCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGHCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATTACGGTACGATCCCGTAGGGTAGGGGGTTAATTGGCTCTGAGGGTTCTYCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCACGTAGGGTAGGGGGTTAAGGCTCTGAGGGAATTCCAATCAATCCTCAATCATCAATCAACTDCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCATCTACCCTTCCTTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTCATCTACCCCCTTTAFCGATOCCCGTAGGGTAGHGCCTCAATCATCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCHATCTACCCCCTTTAFCGATCCCGDTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCATCTACCCCCTTTAFOCGATCCCGTAGGGTAGHGCCTCAATCATCAATCCTCAATCCTTTAFCGATCCCGTAGGGTIAGGATCCTCATCTACCTCTTCCTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAOATCCTCTCAATCCTCAATCAATCCTCATCTACCCCCTTTAFCGATCCCGTAGGGTAGHGCCTCAATCATCAATCCETCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCATCTACCCCCTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTMTCCAATCAATCCTCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGG…

(via delayedlight)

poupon:

(via dysphoricfem-deactivated2020011)

sobeitjay2:

Some people just be filler episodes

(via dontbeanassbutt)

baekphia:

maybe if john green hadnt talked about cock being one of his favorite tastes we wouldn’t be in this big mess 🙄

(via quality-crab-content)

mulletlove:

mulletlove:

lgbt checklist

• non professional haircuts
• inappropriate foot ware
• shirt way 2 small or way 2 big
• had to at one point prepare for a possible future where their family and friends were no longer a support system
• public transit
• substance abuse
• intimacy issues exacerbated by endangering your life by public displays of affection
• fuck cops
• bad memory
• utility related comfort item (The Jacket, The Backpack etc)
• violently hating your body as a teen but realizing it’s other people’s perceptions and expectations of it that you hate in your adult life
• never fucking going to the doctor
• UTIs
• everyone in ur friend group has tried to kill themselves
• maturity at a young age
• flannel

all of u are so surprised that every one of these r applicable….i can tell you exactly why each of them is a universal experience but i bet u can unpack this on ur own….think abt it

(via quality-crab-content)